Medical Mycology , 2026, 64 (6), myag061 https://doi.org/10.1093/mmy/myag061 Published: 11 June 2026 Original Article Effec t of postbiotics on biofilm formation and gene expression in Candida spp. isolates from patients with recurrent vulvovaginal candidiasis Jeiser Marcelo Consuegra-Asprilla

1 , Mariana González-Idarraga1 , Santiago Montoya-Carrascal1 , Dulce

Xiomara Tello-Tobón1 , Andrés Abril Gómez2 , Flaviano Santos Martins2 , and Ángel González

2 , *

1 Basic and Applied Microbiology Research Group (MICROBA), School of Microbiology, Universidad de Antioquia, Medellin 050010, Colombia 2 Laboratory of Biotherapeutic Agents, Department of Microbiology, Institute of Biological Science, Federal University of Minas Gerais, Belo Horizonte, Minas Gerais 31270-901, Brazil ∗To whom correspondence should be addressed: Angel Gonzalez, MSc, PhD, Calle 67 No. 53–108; Of: 5–103, Medellín, Colombia. Tel: + 57-604 219–5489; Fax: + 57-604 219–8494; E-mail: angel.gonzalez@udea.edu.co Abstract First-line treatment for vulvovaginal candidiasis (VVC) has reduced efficacy in patients with recurrent VVC (RVVC), prompting the search for therapeutic alternatives such as probiotics. Recently, postbiotics (cellular components and metabolites derived from probiotics) have gained relevance because they offer similar benefits to probiotics without the risks associated with live microorganisms. This study aimed to evaluate the anti-biofilm effec t of cell-free supernatants (CFSs) derived from probiotic strains against Candida spp. isolates from patients with RVVC, as well as their impact on the expression of genes associated with biofilm formation. Therefore, the anti-biofilm activity of CFSs from Lacticaseibacillus rhamnosus DM-UFMG 63, Bifidobacterium longum 5, 1 A and Lactobacillus acidophilus NCFM SD 5221 was evaluated in 40 Candida spp. isolates. The CFSs from L. acidophilus NCFM SD 5221 and Lc. rhamnosus 63 were analyzed using the XTT assay, and their effect on gene expression was measured by qPCR. At an estimated protein concentration of ∼200 μg/ml, these CFSs significantly inhibited biofilm formation by ∼50% ( P < .01)). This phenotypic effec t corr elated with the downregulation of key biofilm-associated genes ( ALS3 , HWP1 , EFG1 , TEC1 , and UME6 ), alongside a concomitant upregulation of the transcriptional repressor NRG1 . The findings of this study demonstrate that CFSs derived from Lc. rhamnosus DM-UFMG 63 and L. acidophilus NCFM SD 5221 exhibit significant antagonistic activity against biofilm formation in clinical isolates from patients with RVVC. Consequently, these CFSs represent a promising therapeutic and prophylactic alternative for the management of RVVC. Lay summary In some cases, conventional therapies are ineffective against recurrent vulvovaginal candidiasis. This study demonstrates that cell-free supernatants derived from probiotics can inhibit Candida biofilm formation and modulate associated genes, supporting their therapeutic and prophylactic potential. Keywords Candida spp., RVVC, biofilm, postbiotic, cell-free supernatant Introduction Vulvovaginal candidiasis (VVC) is a debilitating infection caused by yeasts of the genus Candida , with Candida albicans being the most common etiological agent associated with this condition .1 Candida albicans is part of the mucosa-associated microbiota that, under certain conditions, can cause disease 2 , 3 ; in this sense, the ability of some species of the genus Candida to undergo the morphological transition from blastoconidia to hypha or pseudohyphae is crucial for promoting the conversion from commensal to pathogen .4 It is estimated that VVC affects ∼75% of the female population at least once in their lifetime 5 ; however, ∼10% of women who suffer fr om VV C pr esent r ecurr ences (RVV C), which is defined as the occurrence of at least three episodes of VVC in 1 year .6 Factors such as pregnancy, hormone replacement therapy, use of oral contraceptives, diabetes, genetic predisposition, fungal virulence factors, and the use of broad-spectrum Received: 23 February 2026. Revised: 4 June 2026. Accepted: 9 June 2026 © The Author(s) 2026. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial License (https://creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact reprints@oup.com for reprints and translation rights for reprints. All other permissions can be obtained through our RightsLink service via the Permissions link on the article page on our site-for further information please contact journals.permissions@oup.com Downloaded from https://academic.oup.com/mmy/article/64/6/myag061/8706379 by guest on 24 June 2026

Medical Mycology, 2026, Volume 64, Issue 6 antibiotics have been reported to be associated with the occurrence of

RVVC .7

The use of broad-spectrum antibiotics can generate dysbiosis in the vaginal microenvironment due to the decrease or eradication of lactic acid bacteria such as Lactobacillus crispatus , L. gasseri , and L. jensenii , which are part of the vaginal microbiota and have the ability to inhibit the excessive growth of C. albicans through various mechanisms, including the production of metabolites such as lactic acid, bacteriocins, antimicrobial peptides, hydrogen peroxide (H2 O2 ) and biosurfactants, in addition to competition for nutrients and epithelial attachment sites. 8 , 9 Probiotics are live microorganisms that, when administered in adequate concentrations, could potentially confer a health benefit to the host .9 Based on this, some species of the genera Lactobacillus and Bifidobacterium are commonly used as vaginal probiotics and are administered orally or vaginally .10 However, recent evidence has shown that the use of probiotics could cause opportunistic systemic and local infections, especially in individuals with predisposing immunological conditions. 11 Thus, in recent years, it has been recognized that, like probiotics, the use of cellular components of microorganisms and their metabolites can generate health benefits for the host. In this sense, the term “postbiotic” has been coined, which is defined as “a preparation of inanimate microorganisms and/or their components (proteins, shortchain fatty acids, vitamins, and amino acids, among others) that confer a health benefit" .12 Despite the recent surge in probiotics as beneficial agents for human health, few studies have evaluated their role in VVC/RVVC. In vitro studies have reported that C. albicans exhibits decreased proliferation when co-cultured with bacteria such as L. crispatus , L. jensenii , L. gasseri , L. reuteri , L. acidophilus , and Lacticaseibacillus rhamnosus . 13–16 Additionally, to date, there are no reports evaluating the anti- Candida capacity of cell-free supernatants (CFSs) derived from probiotics against Candida spp. isolates from patients with RVVC.

Based on the above, the objective of this study was to evaluate the anti-biofilm effec t of CFSs derived from the probiotic strains Lc. rhamnosus 63, Bifidobacterium longum 51A, and L. acidophilus NCFM SD 5221 (Probiac ®) against Candida spp. isolates from patients with RVVC, as well as to determine the expression of genes associated with biofilm formation in response to these postbiotics.

Materials and methods Ethical aspects This study was conducted in accordance with the Declaration of Helsinki, and both the isolates and the clinical information of the participating individuals were obtained from a previous study approved by the Bioethics Committee in Human Research (Act No. 21-28-935) of the University Research Headquarters (SIU) of the University of Antioquia, Medellín, Colombia.

Microorganisms and culture conditions A total of 40 Candida spp. clinical isolates—comprising 37 Candida albicans and three Clavispora lusitaniae (formerly Candida lusitaniae )—were evaluated. These isolates were recovered during a previous study by our research group ,17 where clinical samples were obtained exclusively from patients diagnosed with RVVC. Within this specific cohort, criteria were applied to exclude any isolates originating from patients who presented with co-existing vulval pathologies, diabetes, HIV, cancer, autoimmune diseases, or pregnancy. Furthermore, isolates were excluded if the source patient had a history of antibiotic, antifungal, or corticosteroid therapy within 7 days prior to sample collection. On the other hand, the reference strains C. albicans SC5314 (ATCC MYA-2876) and C. parapsilosis CLIB214 (ATCC 22019) were used. Prior to use, both the strains and the Candida isolates were stored at -80◦C in BHI broth (HIMEDIA, M210I) supplemented with 10% glycerol. After thawing the isolates and strains, they were cultured on Sabouraud Glucose Agar (SDA) (Merck, 103 873) supplemented with 1% penicillin/streptomycin (Sigma-Aldrich, P0781) and incubated at 37◦C for 24 h.

Additionally, three previously characterized probiotic strains donated by the Laboratory of Biotherapeutic Agents of the Department of Microbiology at the Institute of Biological Sciences of the Federal University of Minas Gerais (UFMG) were used: Lacticaseibacillus rhamnosus DM-UFMG 63, 18 Bifidobacterium longum 51A , 19 and Lactobacillus acidophilus NCFM SD 5221 (Probiac®). For the assays, five isolated colonies were inoculated into 5 ml of de Man Rogosa and Sharpe (MRS) broth (Becton Dickinson, 288 210) and incubated at 37◦C with shaking for 48 h under aerobic conditions for Lc. rhamnosus 63 and L. acidophilus NCFM SD 5221, and under anaerobic conditions for B. longum 51A .

Obtaining CFSs from Probiotics CFSs derived from the aforementioned probiotics were obtained after 48 h of incubation in MRS broth (Becton Dickinson, 288 210) until a bacterial concentration of 1.5 × 10 CFU/ml was reached. Subsequently, the cultures were centrifuged at 3500 rpm for 10 min at 4◦C. The resulting supernatants were sterilized using 0.22 μm filters (Minisart®, 16 541). Sterility controls were performed by incubating 1 ml of each CFS at 37◦C for 24 h to assess turbidity, followed by plating aliquots of the CFSs onto BHI agar (HIME- DIA, M211) and incubating them for 48 h at 37◦C .20 Furthermore, the pH of each CFS was determined using a pH meter, and all supernatants were adjusted to a pH range of 7.0–7.2. Additionally, an exploratory estimation of the protein concentration in each CFS was performed via spectrophotometric analysis at 280 nm (A280 ), after which the samples were stored at −20◦C until further use Determination of minimum biofilm inhibitory concentrations and evaluation of the pH effec t of CFSs on Candida spp.

biofilm To determine the minimum biofilm inhibitory concentration (MBIC) and the pH effec t of CFSs, the C. albicans SC5314 strain was used. This strain was cultured in BHI broth (HIMEDIA, M210I) for

24 h at 37◦C. Subsequently, an inoculum of 1 × 106 cells/ml was

adjusted, and 100 μl of this inoculum was added to 96-well microplate wells (NEST Scientific, 701 001). Different v: v concentra- Downloaded from https://academic.oup.com/mmy/article/64/6/myag061/8706379 by guest on 24 June 2026

Medical Mycology, 2026, Volume 64, Issue 6

3

Table 1. List of genes and primers sequences used for qPCR analyses. Phase Gene Primer Nucleotide sequence Reference Adhesion

BCR1

BCR1-F

AGGCATTCCCTGTTGTGGTT

de novo synthesis

BCR1-R

ACAAGCCCAAGTTCACATGC

ALS3

ALS3-F

GTTGGGTTTGGCAGTGGAAC

de novo synthesis

ALS3-R

TACTACCGCTGTGACCACCT

HWP1

HWP1-F

GACCGTCTACCTGTGGGACAGT

22

HWP1-R

GCTCAACTTATTGCTATCGCTTATTACA

Maduration

EFG1

EFG1-F

CATCACAACCAGGTTCTACAACCAAT

22

EFG1-R

CTACTATTAGCAGCACCACCC

TEC1

TEC1-F

ACTATCGGGGCTTGACTCGT

de novo synthesis

TEC1-R

CCAGAAAACGCATCACCCAC

Dispertion

UME6

UME6-F

GCAGCAGCACTAACACTGAC

de novo synthesis

UME6-R

AGATGCAGCAAACCCATCATC

NRG1

NRG1-F

ATCAGACCATCTCCAGGGCT

de novo synthesis

NRG1-R

TGGGTCTTTGCTTTGGGTGT

Housekeeping

ACT1

ACT1-F

TGGAAGCTGCTGGTATTGACC

23

ACT1-R

TGGATGGACCAGATTCGTCG

tions of CFSs were then added to each well at both pH 7 and pH 4, in triplicate, as follows: 6.75%, 12.5%, 25%, and 50%. In addition, a growth control at pH 7 and pH 4 (without supernatant) and an inhibition control with amphotericin B (AmB, 2%) were included. Biofilm formation was evaluated after 48 h at 37◦C. Subsequently, metabolic activity in each well was evaluated using the XTT (Invitrogen, X6493) assay, following the methodology proposed by Pierce et al. .21 Evaluation of the anti-biofilm effec t of differ ent CFSs The biofilm-forming capacity of different Candida isolates from patients with RVVC was evaluated. An inoculum of each Candida spp. isolate or strain was prepared at a concentration of 1 × 106 cells/ml in RPMI 1640 medium (Sigma-Aldrich, R6540) supplemented with 4-morpholinepropanesulfonic acid (MOPS) (Sigma- Aldrich, M1254). The C. albicans SC5314 and C. parapsilosis ATCC

22019 strains were used as positive and negative controls, re-

spectively, for biofilm formation; in addition, a cell-free control and a total inhibition control using amphotericin B (2%) as treatment were also included. In a 96-well microplate (NEST Scientific, 701 001), 100 μl of each inoculum and 25 μl of the differ ent treatments and controls were seeded: CFSs, MRS medium, or AmB 2%. All wells were brought to a final volume of 200 μl using RPMI medium supplemented with MOPS. The plates were incubated at 37◦C for 48 h. After this time, each well was vigorously washed twice with 200μl of PBS, and the excess PBS was discarded. Subsequently, 100 μl of XTT solution (Invitrogen, X6493) supplemented with menadione was added to each well. The plates were incubated for 3 h at 37◦C in the dark. Consequently, 80 μl of the XTT/menadione solution was extracted and transferred to a new 96-well plate. Finally, the metabolic activity of the Candida spp. biofilms was analyzed by measuring the absorbance at 490 nm using a Multiskan FC spectrophotometer (Thermo Scientific,

11 500 695).

RNA Extraction and cDNA Synthesis RNA was extracted from isolates and strains subjected to CFS treatments, as well as from isolates and strains not treated with CFSs, using the TRIzol reagent (Invitrogen, 15 596 026) and following the manufacturer’s instructions. For each treatment, this extraction was performed at 2, 24, and 48 h, corresponding to the biofilm development phases (adhesion, maturation, and dispersion, respectively). This was done to specifically evaluate gene expression during the corresponding biofilm development phase. Furthermore, the integrity, quantity, and quality of the extracted RNA were evaluated by agarose gel electrophoresis and spectrophotometry using the NanoDrop One (Thermo Fisher Scientific), taking into account the 260/230 and 260/280 absorbance ratios to assess sample purity. Subsequently, the samples were treated with DNase using DNase I Amplification Grade (1 unit/μl) (Sigma-Aldrich, 89 836), and then cDNA was synthesized using the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems, 4 368 814) according to the manufacturer’s instructions. Finally, the quality and quantity of the cDNA samples were determined using the NanoDrop One instrument (Thermo Fisher Scientific) under the same conditions described above.

Determination of the expression of genes associated with Candida spp. biofilm formation in response to CFSs To determine the effects of CFSs on the expression of Candida spp. genes related to biofilm formation in the different developmental phases, the expression of the following genes was evaluated by qPCR: BCR1, ALS3, and HWP1 , related to the adhesion phase; EFG1, TEC1 , related to the maturation phase; and UME6 and NRG1 , which are related to the biofilm dispersion phase (Table 1 ). Gene expression was evaluated using qPCR with the ExcelTaq 2 × Fast Q-PCR Master Mix kit, SYBR, without ROX (SMOBIO, TQ1200), and the CFX96 Touch Real-Time PCR system (Bio-Rad). A final volume of 15 μl was used for each reaction, along with the Downloaded from https://academic.oup.com/mmy/article/64/6/myag061/8706379 by guest on 24 June 2026

Medical Mycology, 2026, Volume 64, Issue 6 following amplification protocol: an initial polymerase activation cycle for 20 s at 95◦C, followed by 40 cycles at 95◦C for 15 s with a 30 s melt-and-extension phase. A dissociation protocol was also included to determine the melting curve of each primer, considering a temperature range of 58◦C–95◦C, in order to verify that each primer pair produced only one PCR product. The relative expression of the genes of interest was calculated using the formula 2−Ct , considering the ACT1 gene as the constitutive or normalizing gene.

Statistical analysis Statistical analyses were performed using GraphPad Prism version

9.0 (GraphPad Software, LLC) and R version 4.5.0. Data normality

was assessed using the Shapiro–Wilk test. For non-normally distributed datasets, differences were analyzed using the Kruskal– Wallis test followed by Dunn’s post-hoc multiple comparison test. Conversely, normally distributed data were evaluated via one-way analysis of variance followed by the Holm–Šidák multiple comparison test. Relative gene expression from qPCR assays was calculated using the 2−Ct2 method. Data are expressed as mean ± standard error of the mean or as median with interquartile range from three independent experiments. Statistical significance was strictly defined at P < .05.

Results Estimated protein content in CFSs via spectrophotometric analysis To provide a preliminary baseline of the secretome composition, the protein-associated content of the CFSs was estimated spectrophotometrically at 280 nm (A280 ). Based on the standard analytical premise that an absorbance of 1.0 correlates to ∼1000 μg/ml of total protein, the equivalent concentrations were determined. The analyses revealed comparable protein yields across the strains, with estimated concentrations of 1570 μg/ml for Lacticaseibacillus. rhamnosus DM-UFMG 63, 1580 μg/ml for Lactobacillus acidophilus NCFM SD 5221, and 1640 μg/ml for Bifidobacterium longum 51A.

pH does not alter the anti-biofilm effec t of CFSs against Candida albicans The MBIC of the evaluated probiotic CFSs was determined to be 12.5%, which corresponds to an estimated protein concentration of ∼200 μg/ml. The effec t of pH on the anti-biofilm effec t of the CFSs against Candida spp. isolates was also evaluated, and it was observed that at pH 4 or 7, there was no alteration in the antibiofilm effect of the CFSs against C. albicans (Fig. 1 ). CFSs derived from different probiotics inhibit biofilm formation in Candida spp.

isolates from patients with RVVC The effec t of the CFSs derived from Lc. rhamnosus 63, L. acidophilus NCFM SD 5221, and B. longum 51A on Candida spp. Figure 1. Effect of CFSs (CFSs) obtained from probiotic strains on biofilm-forming capacity of Candida albicans SC5314 at different pH conditions. (A) Lacticaseibacillus rhamnosus DM-UFMG 63, (B) Lactobacillus acidophilus NCFM SD 5221, and (C) Bifidobacterium longum 51A . Biofilm-forming capacity was quantified by measuring absorbance at

490 nm using the XTT reduction assay, after treatment with increasing

concentrations of CFSs ( ∼100 μg/ml–∼800 μg/ml), adjusted to pH 4 or pH 7. Amphotericin B (AmB) was included as a positive control, and untreated wells (–) as growth controls. Data are expressed as the mean ± standard error of the mean (SEM). ∗P < .05; ∗∗P < .01; ns, not significant.

biofilm formation was evaluated using the XTT reduction assay. The CFS from Lc. rhamnosus 63 exerted a robust inhibitory effec t compared to untreated controls, significantly reducing biofilm viability in both C. albicans (95% Confidence Intervalo (CI): −0.2061 to −0.1417; P < .01) and C. lusitaniae (95% CI: −0.4040 to −0.2400; Downloaded from https://academic.oup.com/mmy/article/64/6/myag061/8706379 by guest on 24 June 2026

Medical Mycology, 2026, Volume 64, Issue 6

5

Figure 2. Effect of cell-free supernatants (CFSs) on biofilm-forming capacity of RVVC Candida spp. isolates. CFS derived from: (A) Lacticaseibacillus rhamnosus DM-UFMG 6363, (B) Lactobacillus acidophilus NCFM SD 5221, and (C) Bifidobacterium longum 51A . Biofilm-forming capacity was quantified by measuring absorbance at 490 nm using the XTT reduction assay. A total of 40 Candida spp. isolates (37 Candida albicans ) and 3 Clavispora lusitaniae were evaluated. Amphotericin B (AmB) was included as a positive control, and untreated wells (–) were used as growth controls. Data are expressed as mean ± standard error of the mean (SEM). ∗P < .05; ∗∗P < .01; ∗∗∗P < .001. P < .01). Similarly, the L. acidophilus NCFM SD 5221 CFS induced a significant decrease in biofilm-associated metabolic activity for both C. albicans (95% CI: −0.2540 to −0.1639; P < .01) and C. lusitaniae (95% CI: −0.2664 to −0.1443; P < .01) (Fig. 2 A, B). In contrast, the CFS from B. longum 51A exhibited a more limited antagonistic profile, showing a significant but smaller inhibitory effect exclusively against C. albicans isolates (95% CI: −1.7510 to −0.9040; P < .01), with no significant activity observed against C. lusitaniae (Fig. 2 C).

CFSs derived from Lc. rhamnosus 63 and L.

acidophilus NCFM SD 5221 induce a decrease in the expression of genes associated with the adherence phase during biofilm formation Considering the lesser anti-biofilm effec t observed with the postbiotic derived from B. longum 51A , subsequent gene expression Downloaded from https://academic.oup.com/mmy/article/64/6/myag061/8706379 by guest on 24 June 2026

Medical Mycology, 2026, Volume 64, Issue 6 analyses in Candida spp. isolates from patients with RVVC were performed in the presence or absence of CFSs derived from Lc. rhamnosus 63 and L. acidophilus NCFM SD 5221. Two hours after biofilm formation, a significant decrease in ALS3 gene expression was observed regardless of the CFS evaluated in all the isolates analyzed. Likewise, a decrease in HWP1 expression was observed in C. albicans isolates in the presence of the CFS derived from Lc. rhamnosus 63. With respect to the BCR1 gene, no differ ences in its expression were observed between the treatments evaluated (Fig. 3 A–C).

CFSs derived from Lc. rhamnosus 63 and L.

acidophilus NCFM SD 5221 induce a decrease in the expression of genes associated with the maturation phase during Candida biofilm formation During the biofilm maturation phase (24 h), the CFSs from both probiotics induced a significant decrease in the expression of the TEC1 gene in both C. albicans and C. lusitaniae isolates. For the EFG1 gene, only the CFS from Lc. rhamnosus 63 significantly decreased its expression in C. albicans isolates (Fig. 4 A–B). CFSs from Lc. rhamnosus 63 and L.

acidophilus NCFM SD 5221 altered the expression of genes associated with the dispersion phase during Candida biofilm formation Expression analyses of the NRG1 and UME6 genes, associated with the dispersion phase during Candida spp. biofilm formation, were evaluated at 48 h. In the presence of the CFSs derived from Lc. rhamnosus 63 and L. acidophilus NCFM SD 5221, an increase in NRG1 gene expression was observed in both C. albicans and C. lusitaniae isolates. Interestingly, the L. acidophilus NCFM SD 5221 CFS (Probiac®) induced the highest expression of this gene in all isolates (Fig. 5 A).

Finally, regarding the expression of the UME6 gene, it was observed that only the CFSs derived from Lc. rhamnosus 63 induced a significant decrease in the gene in the C. albicans isolates (Fig. 5 B). Discussion RVVC affects ∼10% of women with VVC. The first-line treatment for VVC/RVVC is azole antifungals .24 However, in some cases, fluconazole does not allow for complete resolution of the disease. Consequently, probiotics have recently been explored as adjunct or alternative therapies .25 Nevertheless, it has been reported that the use of probiotics presents some disadvantages, mainly associated with the intrinsic risk they may pose to the host, especially in immunocompromised populations. 26 , 27 This has shifted a tt ention toward postbiotics—defined as bioactive compounds derived from probiotics .28 CFSs were harvested after 48 h of incubation in MRS broth. This specific time point was selected based on literature indicating that bioactive metabolite production and accumulation by Lacticaseibacillus rhamnosus , Lactobacillus acidophilus , and Bifidobacterium longum peak during the late exponential and stationary growth phases, with robust metabolomic profiles already wellestablished after 24 h. 29 , 30 Furthermore, growth curve kinetics performed in this study confirmed that all evaluated probiotic strains reached cell densities in the order of 109 CFU/ml at 48 h, a yield comparable to commercial probiotic formulations .31 Thus, this incubation period ensured standardized conditions for both bacterial biomass and metabolite accumulation across all strains. Following harvest, a spectrophotometric estimation of the protein-associated components in the CFSs was conducted at

280 nm (A280 ). The analysis revealed highly comparable protein

profiles among the secretomes, yielding estimated concentrations of 1,70 μg/ml for Lc. rhamnosus 63, 1580 μg/ml for L. acidophilus NCFM SD 5221, and 1640 μg/ml for B. longum 51A. However, these values represent relative estimations of total protein content rather than absolute quantifications of purified proteins or specific bioactive fractions. Consequently, the precise temporal characterization of metabolite secretion throughout the distinct growth phases was outside the scope of this preliminary report and remains an important avenue for future mechanistic investigations.

Moreover, given that the low pH induced by lactic acid bacteria has been reported as one of the main protective factors against the proliferation of Candida spp. in the vaginal microenvironment ,32 this study first evaluated the effect of pH on the efficacy of CFSs derived from Lc. rhamnosus 63, B. longum 51A , and L. acidophilus NCFM SD 5221 (Probiac®) against the biofilm formation of Candida albicans SC5314. However, the CFSs evaluated at both pH 4 and pH 7 showed significant anti-biofilm activity. Thus, contrary to y Boahen et al. ,33 our findings suggest that the pH associated with the organic acids produced by the evaluated probiotics is not the mechanism related to the inhibition of Candida spp. biofilm. This suggests that, at least for the CFSs evaluated in this study, factors other than pH may be exerting a significant anti-biofilm effect. These findings are similar to those obtained in another study that evaluated the effect of pH on CFSs derived from various probiotics against C. parapsilosis ATCC 22019, and in which it was observed that the evaluated CFSs exhibited a similar inhibitory effec t at both acidic and neutral pH .20 Likewise, a recently study evaluated the CFSs from Lc. rhamnosus ATCC 53103, Lactiplantibacillus plantarum ATCC 8014, and L. acidophilus ATCC 4356 against C. albicans SC5314 and six clinical isolates (comprising two strains each of C. albicans , C. tropicalis , and C. parapsilosis ); in alignment with our observations, the authors reported that the Lc. rhamnosus CFS sustained its inhibitory capacity even at a neutralized pH (pH 7.0), strongly suggesting that bioactive metabolites other than organic acids contribute to the observed antifungal activity .34 This phenomenon is further supported by Garcia-Gamboa et al. ,35 who demonstrated that CFSs derived from L. plantarum modulated the growth of C. albicans and Candida kefyr . Notably, and mirroring our own findings, a CFS concentration of 200 μg/ml was sufficient to significantly inhibit the growth of both Candida species, reinforcing the potent anti-candidal profile of these probiotic secretomes.

Interestingly, the CFSs derived from Lc. rhamnosus 63 and L. acidophilus NCFM SD 5221 (Probiac ®) showed a greater anti-biofilm effect than the CFS derived from B. longum 51A . This aligns with evidence that, unlike B. longum , both Lc. rhamnosus and L. aci- Downloaded from https://academic.oup.com/mmy/article/64/6/myag061/8706379 by guest on 24 June 2026

Medical Mycology, 2026, Volume 64, Issue 6

7

Figure 3. Effect of cell-free supernatants (CFSs) on the relative expression of adhesion phase biofilm-associated genes in RVVC Candida spp. isolates. (A) ALS3 , (B) HWP1 , and (C) BCR1 genes. Gene expression was quantified by Reverse Transcription Quantitative Polymerase Chain Reaction (RT-qPCR) and expressed as 2−Ct following exposure to Lacticaseibacillus rhamnosus DM-UFMG 63 and Lactobacillus acidophilus NCFM SD 5221 CFSs. A total of 40 Candida spp. isolates (37 Candida albicans ) and 3 Clavispora lusitaniae were evaluated. (–) Untreated control wells. Data are expressed as median and interquartile range (IQR). Adjusted P -values are indicated as follows: ∗P < .05; ∗∗P < .01; ∗∗∗P < .001. Downloaded from https://academic.oup.com/mmy/article/64/6/myag061/8706379 by guest on 24 June 2026

Medical Mycology, 2026, Volume 64, Issue 6 Figure 4. Effect of cell-free supernatants (CFSs) on relative expression of maturation-phase biofilm-associated genes in RVVC Candida spp. isolates. (A) TEC1 and (B) EFG1 genes. Gene expression was quantified by RT-qPCR and expressed as 2−Ct following exposure to Lacticaseibacillus rhamnosus DM-UFMG 63 and Lactobacillus acidophilus NCFM SD 5221 CFSs. A total of 40 Candida spp. isolates (37 Candida albicans ) and 3 Clavispora lusitaniae were evaluated. (–) untreated control wells. Data are expressed as median and interquartile range (IQR). Adjusted P s are indicated as follows: ∗P < .05; ∗∗P <

.01.

dophilus are bacterial species with a great capacity to produce secondary metabolites such as biosurfactants and antimicrobial peptides, which can reduce microbial adhesion by altering the membrane structure, which can result in inadequate protein interactions and cell lysis, thus preventing pathogen biofilms from developing successfully. 36–39 Candida biofilm development is mainly divided into adhesion, maturation, and dispersion .40 To elucidate the possible molecular mechanisms related to the inhibition of biofilm formation in the presence of the evaluated CFSs, this study, for the first time, assessed the expression of genes related to biofilm formation at three different time points, considering the phases of biofilm development. Thus, 2 h after biofilm formation, the expression of genes related to the adhesion phase—A LS3 , HWP1 , and BCR1 — was evaluated. These genes encode proteins essential for Candida adhesion, morphogenesis, and biofilm formation, and therefore play an important role in Candida pathogenesis. Regarding ALS3 and HWP1 , it was observed that in the presence of the CFSs from Lc. rhamnosus 63 and L. acidophilus NCFM SD 5221, these genes showed a significant decrease in their expression. These results are interesting, considering that the ALS3 gene encodes an adhesion protein expressed in hyphae, which is important for the initial interaction between Candida spp. and the extracellular matrix, whether of epithelial cells or abiotic surfaces; therefore, the de- Downloaded from https://academic.oup.com/mmy/article/64/6/myag061/8706379 by guest on 24 June 2026

Medical Mycology, 2026, Volume 64, Issue 6

9

Figure 5. Effect of cell-free supernatants (CFSs) on relative expression of dispersion-phase biofilm-associated genes in Candida isolates. (A) NRG1 and (B) UME6 genes. Gene expression was quantified by RT-qPCR and expressed as 2−Ct following exposure to Lacticaseibacillus rhamnosus DM-UFMG 63 and Lactobacillus acidophilus NCFM SD 5221 CFSs. A total of 40 Candida spp. isolates (37 Candida albicans ) and 3 Clavispora lusitaniae were evaluated. (–) Untreated controls. Data are expressed as median and interquartile range (IQR). Adjusted P -values are indicated as follows: ∗P < .05; ∗∗P < .01; ∗∗∗P <

.001.

crease in ALS3 expression could be related not only to a decrease in adhesion capacity, but also to a decrease in the ability to capture essential microelements such as iron, since it has been reported that the Als3 protein also binds to ferritin of host cells .41 Additionally, with respect to HWP1 , this gene encodes a hyphal cell wall protein, which is essential for proper filamentation. In this regard, reduced HWP1 expression likely contributes to the inhibition of biofilm formation in Candida observed in our study, since Candida hwp1 strains have been reported to exhibit structurally defective biofilms .42 Furthermore, similar to our findings, a study by Wang et al. using the C. albicans ATCC 10231 strain determined the expression of ALS3 and HWP1 in the presence of CFSs derived from

L. crispatus and showed a decrease in their gene expression .43

Additionally, 24 h after biofilm formation, the expression of genes related to the maturation phase was evaluated in the presence of CFSs, and a decrease in the expression of the EFG1 and TEC1 genes was observed. These genes are important transcription factors associated with the biofilm formation process, as they directly regulate the expression of genes such as ALS3 and HWP1 . Therefore, this finding is consistent with the decreased gene expression observed for ALS3 and HWP1 in the presence of CFSs derived from Lc. rhamnosus 63 and L. acidophilus NCFM SD 5221. From this, it could be inferred that the effect of CFSs is not isolated, but rather that they possibly affect the entire regulatory cascade of biofilm formation. Consistent with our findings, in a study by Poon et al ., it was shown that both EFG1 and TEC1 were negatively Downloaded from https://academic.oup.com/mmy/article/64/6/myag061/8706379 by guest on 24 June 2026

Medical Mycology, 2026, Volume 64, Issue 6 regulated in C. albicans isolates subjected to CFS treatment from Lc. rhamnosus and L. plantarum .34 Finally, 48 h after biofilm formation, the expression of the UME6 and NRG1 genes was evaluated in the presence of CFSs. These genes are related to the final phase of biofilm dispersion. The assays showed an increase in NRG1 gene expression in the isolates in the presence of the CFSs; this finding is similar to that reported by Wang et al ., who evaluated the expression of this gene in the presence of CFSs derived from L. crispatus, L. gasseri , and L. jensenii , and observed that, regardless of the CFS evaluated, NRG1 expression was positively regulated .43 These findings are important because NRG1 has been reported as a negative regulator of genes such as HWP1 and ALS3 , which are essential for proper biofilm development. This could be relevant in vivo , since an increase in NRG1 could significantly decrease the virulence capacity of Candida , as this gene favors the maintenance of the blastoconidia morphotype as the main morphological state of Candida .44 Similarly, Li et al. 45 evaluated the anti- Candida activity of CFSs derived from Lacticaseibacillus paracasei CPU-Lps0708 against C. albicans ATCC 14053. In alignment with our observations, the authors demonstrated that the CFS upregulated the expression of the NRG1 gene, resulting in an ∼35% inhibition of biofilm formation. These convergent lines of evidence strongly support the notion that a key regulatory mechanism mediated by Lacticaseibacillus species—such as Lc. rhamnosus and Lc. paracasei —involves the upregulation of NRG1 , thereby restricting filamentation and subsequent biofilm assembly in Candida spp.

Additionally, a decrease in UME6 expression was observed in the presence of the CFS derived from Lc. rhamnosus 63, which is relevant considering that this gene is necessary for Candida to maintain the hyphal morphotype stably. This finding is related to the findings of Poon et al ., who observed that in the presence of CFS derived from L. plantarum ATCC 8014 (LP8014), UME6 expression was downregulated in C. albicans SC531434 . Additionally, in another study where the effect of co-culture of C. albicans with Lactobacillus paracasei 28.4 was evaluated, a reduction in the expression of UME6 was reported, which was associated with inadequate hyphal development and a higher survival rate in an in vivo model of Caenorhabditis elegans . 46 Limitations of the study Despite the relevance of the findings, this exploratory study has some limitations that should be acknowledged. First, CFSs demonstrated a robust anti-biofilm effec t; their ac tive components were not chemically or biochemically characterized. Therefore, while the observed effec t s ar e likely associated with metabolites such as antimicrobial peptides, biosurfactants, or other secreted compounds, the specific molecules and mechanisms involved remain to be elucidated. Second, biofilm inhibition was primarily assessed using the XTT reduction assay, which reflects metabolic activity but does not allow for direct discrimination between fungistatic, fungicidal, or purely metabolic effects. In addition, although many clinical isolates were evaluated, the small number of Clavispora lusitaniae isolates limits species-specific inferences, and these results should be interpreted as exploratory. Finally, the experiments were performed under in vitro conditions, which do not fully reproduce the complexity of the vaginal microenvironment, including host immune responses, epithelial interactions, and microbiota dynamics. Future studies combining biochemical characterization and extraction-based quantification methods of postbiotic components and in vivo infection models will be essential to confirm the translational potential of these findings.

In conclusion, the findings of this study demonstrate that the CFSs derived from Lacticaseibacillus rhamnosus DM-UFMG 63 and Lactobacillus acidophilus NCFM SD 5221 exhibit a significant antagonistic effec t against biofilm formation in Candida albicans and

C. lusitaniae isolates from patients with RVVC. Furthermore, con-

trary to reports by other authors, the anti- Candida effect of the evaluated CFSs was shown to result from the action of metabolites such as bacteriocins and biosurfactants, rather than from an acidic pH. These metabolites may directly influence the regulation of genes essential for biofilm formation.

Specifically, the evaluated CFSs significantly reduced the expression of the genes ALS3, HWP1 , EFG1, TEC1 , and UME6, while increasing the expression of the negative regulator NRG1 . These interesting findings indicate that the use of CFSs could represent both a therapeutic and prophylactic approach for the management of RVVC. However, further studies are needed to specifically elucidate the molecular mechanisms by which CFSs derived from Lc. rhamnosus DM-UFMG 63 and L. acidophilus NCFM SD 5221 exert their anti-biofilm effec t s on Candida . This should also include the use of an in vivo infection model to evaluate the effec t s of these CFSs in humans.

Author contributions Jeiser Marcelo Consuegra-Asprilla (Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Validation, Writing—review & editing), Mariana González-Idarraga (Formal analysis, Investigation, Methodology, Writing—review & editing), Santiago Montoya-Carrascal (Formal analysis, Investigation, Methodology, Writing—review & editing), Dulce Xiomara Tello- Tobón (Formal analysis, Investigation, Methodology, Writing— review & editing), Andrés Abril Gómez (Formal analysis, Investigation, Methodology, Writing—review & editing), Flaviano Santos Martins (Formal analysis, Investigation, Validation, Visualization, Writing—review & editing), Ángel González (Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Methodology, Project administration, Resources, Supervision, Validation, Visualization, Writing—original draft, Writing— review & editing).

Declaration of interest The authors declare that they have no financial conflict of interest. References

1. Intra J, Sala MR, Brambilla P, Carcione D, Leoni V. Prevalence

and species distribution of microorganisms isolated among non-pregnant women affec ted by vulvovaginal candidiasis: A retrospective study over a 20-year period. J Med Mycol . 2022;

32 (3): 101278. https://doi.org/10.1016/j.mycmed.2022.1012

78

2. Pérez JC. Fungi of the human gut microbiota: Roles and sig-

nificance. Int J Med Microbiol . 2021; 311 (3): 151490. https: //doi.org/10.1016/j.ijmm.2021.151490 Downloaded from https://academic.oup.com/mmy/article/64/6/myag061/8706379 by guest on 24 June 2026

Medical Mycology, 2026, Volume 64, Issue 6

11

3. Nobile CJ, Johnson AD. Candida albicans biofilms and human

disease. Annu Rev Microbiol . 2015; 69: 71–92. https://doi.org/ 10.1146/annurev- micro- 091014- 104330

4. Min K, Park A. Shape-shifting mechanisms: Integrative multi-

omics insights into Candida albicans morphogenesis. Mycobiology . 2025; 53 (2): 250–257. https://doi.org/10.1080/122980

93.2025.2460304

5. Sobel JD. Vulvovaginal candidosis. The Lancet . 2007; 369

(9577): 1961–1971. https://doi.org/10.1016/S0140-6736(07)6

0917-9

6. Workowski KA. Sexually transmitted infections treatment

guidelines, 2021. MMWR Recomm Rep . 2021; 70.

7. de Cássia O, Sardi J, Silva DR, Anibal PC et al. Vulvovaginal

candidiasis: epidemiology and risk factors, pathogenesis, resistance, and new therapeutic options. Curr Fung Infect Rep . 2021; 15: 32–40.

8. Zangl I, Pap IJ, Aspöck C, Schüller C. The role of Lactobacillus

species in the control of Candida via biotrophic interactions. Microb Cell. 2019; 7 (1): 1–14. https://doi.org/10.15698/mic20

20.01.702

9. Joint FAO/WHO Expert Consultation on Evaluation of Health

and Nutritional Properties of Probiotics in Food Including Powder Milk with Live Lactic Acid Bacteria. Report of a Joint FAO/WHO Expert Consultation on Evaluation of Health and Nutritional Properties of Probiotics in Food Including Powder Milk with Live Lactic Acid Bacteria. In: 1st ed. 2002. Accessed January 21, 2026. https://openknowledge.fao.org/ha ndle/20.500.14283/y6398e

10. Andrade JC, Kumar S, Kumar A, ˇCernáková L, Rodrigues CF.

Application of probiotics in candidiasis management. Crit Rev Food Sci Nutr . 2022; 62 (30): 8249–8264. https://doi.org/10.1 080/10408398.2021.1926905

11. Liu X, Zhao H, Wong A. Accounting for the health risk of probi-

otics. Heliyon . 2024; 10 (6): e27908. https://doi.org/10.1016/j. heliyon.2024.e27908

12. Salminen S, Collado MC, Endo A et al. The International Sci-

entific Association of Probiotics and Prebiotics (ISAPP) consensus statement on the definition and scope of postbiotics. Nat Rev Gastroenterol Hepatol . 2021; 18 (9): 649–667. https: //doi.org/10.1038/s41575- 021- 00440- 6

13. McKloud E. Understanding recurrent vulvovaginal candidia-

sis as a dynamic biofilm disease of Candida and Lactobacillus . PhD. University of Glasgow; 2021. Accessed November 14,

2023. https://theses.gla.ac.uk/82609 /

14. Authier H, Salon M, Rahabi M et al. Oral administration of Lac-

tobacillus helveticus LA401 and Lactobacillus gasseri LA806 combination attenuates oesophageal and gastrointestinal candidiasis and consequent gut inflammation in mice. J Fungi . 2021; 7 (1): 57. https://doi.org/10.3390/jof7010057

15. Jørgensen MR, Kragelund C, Jensen PØ, Keller MK, Twetman

S. Probiotic Lactobacillus reuteri has antifungal effec t s on oral Candida species in vitro . J Oral Microbiol . 2017;9 (1): 1274582. https://doi.org/10.1080/20002297.2016.1274582

16. Salari S, Ghasemi Nejad Almani P. Antifungal effec t s of Lacto-

bacillus acidophilus and Lactobacillus plantarum against different oral Candida species isolated from HIV/AIDS patients: An in vitro study. J Oral Microbiol . 2020; 12 (1): 1769386. https: //doi.org/10.1080/20002297.2020.1769386

17. Consuegra-Asprilla JM, Rodríguez-Echeverri C, Posada DH,

Gómez BL, González Á. Patients with recurrent vulvovaginal candidiasis exhibit a decrease in both the fungicidal activity of neutrophils and the proliferation of peripheral blood mononuclear cells. Mycoses . 2024; 67 (4): e13720. https://do i.org/10.1111/myc.13720

18. Damaceno QS, Gallotti B, Reis IMM et al. Isolation and identi-

fication of potential probiotic bacteria from human milk. Probiotics Antimicrob Proteins . 2023; 15 (3): 491–501. https://doi. org/10.1007/s12602- 021- 09866- 5

19. da Silva JGV, Vieira AT, Sousa TJ et al. Comparative genomics

and in silico gene evaluation involved in the probiotic potential of Bifidobacterium longum 51A. Gene . 2021; 795: 145781. https://doi.org/10.1016/j.gene.2021.145781

20. Spaggiari L, Sala A, Ardizzoni A et al. Lactobacillus aci-

dophilus , L. plantarum , Lc. rhamnosus , and L. reuteri cell-free supernatants inhibit Candida parapsilosis pathogenic potential upon infection of vaginal epithelial cells monolayer and in a transwell coculture system in vitro . Microbiol Spectr . 2022; 10 (3): e0269621. https://doi.org/10.1128/spectrum.026

96-21

21. Pierce CG, Uppuluri P, Tristan AR et al. A simple and repro-

ducible 96-well plate-based method for the formation of fungal biofilms and its application to antifungal susceptibility testing. Nat Protoc . 2008;3 (9): 1494–1500. https://doi.org/10 .1038/nport.2008.141

22. Nailis H, Coenye T, Van Nieuwerburgh F, Deforce D, Nelis

HJ. Development and evaluation of differ ent normalization strategies for gene expression studies in Candida albicans biofilms by real-time PCR. BMC Mol Biol . 2006;7: 25. https:// doi.org/10.1186/1471- 2199- 7- 25

23. Consuegra-Asprilla JM, Taborda F, Pérez V et al. Virulence of

Candida spp. isolates from patients with recurrent vulvovaginal candidosis is associated with the number of episodes. Mycoses . 2025; 68 (2): e70031. https://doi.org/10.1111/myc.7003

1

24. Liu Z, Yang H, Huang R, Li X, Sun T, Zhu L. Vaginal mycobiome

characteristics and therapeutic strategies in vulvovaginal candidiasis (VVC): differentiating pathogenic species and microecological features for stratified treatment. Clin Microbiol Rev . 2025; 38 (2): e00284–24. https://doi.org/10.1128/cmr.00284-

24 .

25. Wu Y, Hu S, Wu C, Gu F, Yang Y. Probiotics: Potential novel ther-

apeutics against fungal infections. Front Cell Infect Microbiol . 2022; 11: 793419. https://doi.org/10.3389/fcimb.2021.793419

26. Land MH, Rouster-Stevens K, Woods CR, Cannon ML, Cnota J,

Shetty AK. Lactobacillus sepsis associated with probiotic therapy. Pediatrics . 2005; 115 (1): 178–181. https://doi.org/10.154 2/peds.2004-2137 .

27. Liu X, Zhao H, Wong A. Accounting for the health risk of probi-

otics. Heliyon . 2024; 10 (6): e27908. https://doi.org/10.1016/j. heliyon.2024.e27908

28. Boahen A, Than LTL, Loke YL, Chew SY. The antibiofilm role

of biotics family in vaginal fungal infections. Front Microbiol . 2022; 13: 787119. https://doi.org/10.3389/fmicb.2022.787119

29. Spaggiari L, Pedretti N, Ricchi F et al. An untargeted

metabolomic analysis of Lacticaseibacillus (L.) rhamnosus, Lactobacillus (L.) acidophilus, Lactiplantibacillus (L.) plantarum and Limosilactobacillus (L.) reuteri reveals an upregulated production of inosine from L. rhamnosus . Microorganisms . 2024; 12 (4): 662. https://doi.org/10.3390/microorganisms12040662 Downloaded from https://academic.oup.com/mmy/article/64/6/myag061/8706379 by guest on 24 June 2026

Medical Mycology, 2026, Volume 64, Issue 6

30. Audy J, Labrie S, Roy D, LaPointe G. Sugar source modulates

exopolysaccharide biosynthesis in Bifidobacterium longum subsp. longum CRC 002. Microbiology . 2010; 156 (3): 653–664. https://doi.org/10.1099/mic.0.033720-0

31. Hill C, Guarner F, Reid G et al. The International Scientific As-

sociation for Probiotics and Prebiotics consensus statement on the scope and appropriate use of the term probiotic. Nat Rev Gastroenterol Hepatol . 2014; 11 (8): 506–514. https://doi. org/10.1038/nrgastro.2014.66

32. Jiang Q, Stamatova I, Kari K, Meurman JH. Inhibitory activ-

ity in vitro of probiotic lactobacilli against oral Candida under differ ent f ermentation conditions. Benef Microbes . 2015;6 (3): 361–368. https://doi.org/10.3920/BM2014.0054

33. Boahen A, Chew SY, Neela VK, Than LTL. Limosilactobacillus

reuteri 29A cell-free supernatant antibiofilm and antagonistic effects in murine model of vulvovaginal candidiasis. Probiotics Antimicrob Proteins . 2023; 15 (6): 1681–1699. https://doi. org/10.1007/s12602- 023- 10050- 0 .

34. Poon Y, Hui M. Inhibitory effec t of lac tobacilli supernatants

on biofilm and filamentation of Candida albicans , Candida tropicalis , and Candida parapsilosis . Front Microbiol . 2023; 14:

1105949. https://doi.org/10.3389/fmicb.2023.1105949

35. García-Gamboa R, Perfecto-Avalos Y, Gonzalez-Garcia J,

Alvarez-Calderon MJ, Gutierrez-Vilchis A, Garcia-Gonzalez A. In vitro analysis of postbiotic antimicrobial activity against Candida species in a minimal synthetic model simulating the gut mycobiota in obesity. Sci Rep . 2024; 14 (1): 16760. https://doi.org/10.1038/s41598- 024- 66806- 3

36. Patel M, Siddiqui AJ, Hamadou WS et al. Inhibition of bacte-

rial adhesion and antibiofilm activities of a glycolipid biosurfactant from Lactobacillus rhamnosus with its physicochemical and functional properties. Antibiotics . 2021; 10 (12): 1546. https://doi.org/10.3390/antibiotics10121546

37. Tan Y, Leonhard M, Moser D, Schneider-Stickler B. Inhi-

bition activity of lactobacilli supernatant against fungalbacterial multispecies biofilms on silicone. Microb Pathog . 2017; 113: 197–201. https://doi.org/10.1016/j.micpath.2017.1

0.051

38. Barzegari A, Kheyrolahzadeh K, Hosseiniyan Khatibi SM, Shar-

ifi S, Memar MY, Zununi Vahed S. The battle of probiotics and their derivatives against biofilms. Infect Drug Resist . 2020; Volume 13: 659–672. https://doi.org/10.2147/IDR.S232982

39. Wilson RM, Walker JM, Beld J, Yin K. Lactobacillus acidophilus

(strain Scav) postbiotic metabolites reduce infection and modulate inflammation in an in vivo model of Pseudomonas aeruginosa wound infection. J Appl Microbiol . 2025; 136 (3): lxaf061. https://doi.org/10.1093/jambio/lxaf061

40. Rodríguez-Cerdeira C, Gregorio MC, Molares-Vila A et al.

Biofilms and vulvovaginal candidiasis. Colloids Surf B Biointerfaces . 2019; 174: 110–125. https://doi.org/10.1016/j.colsur fb.2018.11.011 .

41. Liu Y, Filler SG. Candida albicans Als3, a multifunctional ad-

hesin and invasin. Euk Cell . 2011; 10 (2): 168–173. https://doi. org/10.1128/ec.00279-10

42. Nobile CJ, Nett JE, Andes DR, Mitchell AP. Function of Candida

albicans adhesin Hwp1 in biofilm formation. Euk Cell . 2006;5 (10): 1604–1610. https://doi.org/10.1128/EC.00194-06

43. Wang S, Wang Q, Yang E, Yan L, Li T, Zhuang H. Antimicro-

bial compounds produced by vaginal Lactobacillus crispatus are able to strongly inhibit Candida albicans growth, hyphal formation and regulate virulence-related gene expressions. Front Microbiol . 2017;8: 258246.

44. Murad AMA, Leng P, Straffon M et al. NRG1 represses yeast–

hypha morphogenesis and hypha-specific gene expression in Candida albicans . EMBO J . 2001; 20 (17): 4742–4752. https:// doi.org/10.1093/emboj/20.17.4742

45. Li Y, Zhou S, Lessing DJ, Chu W. Lacticaseibacillus paracasei

regulates vaginal microecology and inhibits hyphae formation for Candida vaginitis therapy. Probiotics Antimicrob Proteins . 2025; Online ahead of Print. https://doi.org/10.1007/s1

2602- 025- 10840- 8

46. de Barros PP, Scorzoni L, Ribeiro F, de C et al. Lactobacillus

paracasei 28.4 reduces in vitro hyphae formation of Candida albicans and prevents the filamentation in an experimental model of Caenorhabditis elegans . Microb Pathog . 2018; 117: 80–87. https://doi.org/10.1016/j.micpath.2018.02.019 Received: 23 February 2026. Revised: 4 June 2026. Accepted: 9 June 2026 © The Author(s) 2026. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial License ( https://creativecommons.org/licenses/by-nc/4.0/ ), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact reprints@oup.com for reprints and translation rights for reprints. All other permissions can be obtained through our RightsLink service via the Permissions link on the article page on our site-for further information please contact journals.permissions@oup.com Downloaded from https://academic.oup.com/mmy/article/64/6/myag061/8706379 by guest on 24 June 2026